Są takie wyprawy, które odbywa się, żeby coś odkryć, zobaczyć, sfotografować. Są takie, na które udajemy się, żeby coś przeżyć. Są wyprawy badawcze, są krajoznawcze, a niektórzy nawet odbywają wyprawy duchowe.

Każdy, kto czyta opowieści o Bojara i moich wyprawach wie, że nasze wyprawy są wszystkim tym naraz.

Dziś zabierzemy Cię, Przyjacielu na „drugą” stronę – do czeskich Karkonoszy. Ujrzymy jeden z największych cudów natury tego zakątka świata, czyli Labské údolí – Dolinę Łaby.

Wyruszamy z pięknej, położonej w samym sercu czeskich Karkonoszy małej miejscowości, zwanej Špindlerův Mlýn – Młyn Spindlerów. Ciekawa historia wiąże się z tym, skąd wzięła się ta nazwa. Pod koniec XVIII wieku władzę w Austrii (pod której zaborem znajdowały się Czechy) objął cesarz Józef II. Przeprowadził on szeroko zakrojoną reformę kościelną. Zlikwidował większość zakonów, skonfiskował majątki, a sieć parafialną i duchowieństwo, mimo jęków oburzonego papiestwa, poddał pod kontrolę państwa. Jako że od tego czasu parafie miały być swego rodzaju urzędami państwowymi, postanowił między innymi, że sieć parafialną należy zorganizować tak, żeby żaden obywatel nie miał do kościoła dalej, niż godzinę drogi.

Postanowili na tym skorzystać mieszkańcy małej, zagubionej w górach wsi Svatý Petr, ciągnącej się wzdłuż jednej z bocznych dolin, odchodzących od doliny rzeki Łaby. Najbliższy kościół bowiem mieli aż we Vrchlabí, czyli ponad 16 kilometrów drogi od centrum wsi. Napisali więc podanie do cesarskich urzędów o ustanowienie im parafii. Ponieważ wielkim poważaniem w miejscowości cieszył się młynarz Spindler, to u niego, w położonym na samym dole wsi, nad Łabą młynie – zbierali się mieszkańcy i wspólnie układali treść podania. Dlatego też w nagłówkach wysyłanych do urzędów pism umieszczano: „Dan w młynie Spindlera”, data.

Po wielu skomplikowanych zabiegach, początkowych odmowach, kolejnych podaniach – w roku 1793 prośbę rozpatrzono pozytywnie, erygowano nową parafię oraz zlecono budowę nowego kościoła. Jednakże cesarski urzędnik popełnił katastrofalną omyłkę i zamiast ustanowić parafię w miejscowości Svatý Petr – napisał… „w Młynie Spindlera”.

Mieszkańcy stanęli przed niemałym problemem. Wszak błędna nazwa miejscowości unieważniała cały edykt. Czy prostować pomyłkę? To by oczywiście wydłużyło procedurę, a jak wiadomo – biurokracja nie ma w zwyczaju działać szybko.

W końcu zdecydowano, że dolna część wsi, ta położoną w pobliżu Łaby, będzie się odtąd nazywać Špindlerův Mlýn i będzie traktowana formalnie jako osobna miejscowość – a tym samym cały problem zostanie ominięty.

Z czasem dolna część wsi rozrosła się, stała się kurortem i punktem wyjścia dla udających się w góry turystów.  Nieszczęsny kościół, sprawca całego zamieszania do dziś stoi na wzgórzu ponad centrum miejscowości, a nad Łabą, w pobliżu miejsca, gdzie stał niegdyś młyn dziś podziwiać możemy drewnianą figurę młynarza, który przez przypadek stał się założycielem nowego miasteczka.

Centralnym punktem i symbolem miasteczka jest dziś Bílý most – Biały Most nad Łabą. Tutaj też zaczniemy naszą dzisiejszą wędrówkę.

Jeżeli zdecydujesz się, Przyjacielu, wybrać kiedyś naszymi śladami, nie zapomnij wstąpić do położonego nad brzegiem Łaby, tuż obok mostu, niewielkiego parku. Nie bez powodu zwracam na niego Twoją uwagę. Jest to bowiem miejsce, które dużo mówi o tym, co w Czechach jest ważne – a do czego w Polsce żadnej wagi się nie przykłada.

Cały park pełen jest tablic poświęconych okolicznej Przyrodzie. Są tu takie, które opowiadają o rosnących w okolicy roślinach, a są takie, które mówią o żyjących w Łabie pstrągach. Jest nawet tablica, poświęcona… anatomii ryb! A wszystko to w formie uprzystępnionej także dla najmłodszych, ale bynajmniej nie infantylnej – swoją wiedzę mogą tu poszerzyć także dorośli.

Park został w ten sposób wyposażony przez urząd miasta Špindlerův Mlýn, nie przez park narodowy czy organizację ekologiczną. Jakaż to różnica z Polską, gdzie rządzący przeważnie są po pierwsze nieukami, po drugie nie ma wśród nich ludzi mających o Przyrodzie jakiekolwiek pojęcie. Nic zresztą dziwnego, skoro takim wzięciem cieszą się w Polsce studia z politologii, zarządzania czy tym podobnych bzdur.

Napomknę tu przy okazji – ale to sprawa tylko i wyłącznie mojego prywatnego gustu – że nie rozumiem, w jakim w ogóle celu studiuje się coś takiego, jak „zarządzanie”, skoro wszyscy menadżerowie, dyrektorzy czy kierownicy, których spotkałem w życiu, mieli wykształcenie najwyżej niepełne średnie.

Wiele razy spotkałem się z tym, że przeciętny Czech ma większe pojęcie o biologii, niż przeważająca większość Polaków. No, ale czegóż tu wymagać, skoro największy nacisk w polskiej edukacji kładzie się nie na nauki ścisłe, ale na bzdury, typu znajomość encyklik Jana Pawła II albo wiersza „Z pamiętnika Zosi Bobrówny”; gdzie pod pojęciem patriotyzmu rozumie się bycie ogolonym na łyso i z gołą klatą biegającym, neonazistowskim debilem; gdzie każdy jest ekspertem od historii i uważa, że jego wersja tejże historii jest pewna niczym twierdzenie Pitagorasa; gdzie wreszcie za najwyższe autorytety w kwestii Przyrody uważa się leśników, myśliwych i pana Cejrowskiego. Czasami jeszcze księdza proboszcza.

Tak na marginesie dodam, że choć w Czechach katolików i w ogóle wierzących jest mikroskopijna mniejszość, to nie widziałem kościoła, na którym zegar by nie działał, co o dziwo w ultrakatolickiej Polsce jest zjawiskiem nagminnym.

Ale porzućmy te niewesołe refleksje! Tutejszy park jest miejscem, gdzie nie tylko można się czegoś dowiedzieć o Przyrodzie: można Ją także przeżyć, siadając na ławce, zapominając o wszystkim i po prostu wsłuchując się w potężny szum wielkiej rzeki Łaby.

Zaraz za parkiem ujrzymy drugi most – to wybudowana w czasach współczesnych Krytá lávka – Kryta Kładka. Swoim kształtem nawiązuje do starego, Białego Mostu, w odróżnieniu jednak pomalowana jest na ciemno. Oto bowiem za nią zaczynają się już głębiny gór i ciemnego lasu.

Lasy wokół Špinderova Mlýna pełne są roślin zielnych. My wybraliśmy się tutaj na początku maja, a był to czas, gdy zima wciąż jeszcze trzymała okoliczną Przyrodę w ryzach, nie pozwalając stopnieć śniegom na górach, a drzewom wypuścić liści. Nic dziwnego więc, że najwięcej znaleźć mogliśmy przedstawicieli geofitów – roślin, które kwitną jako pierwsze, gdy tylko nadarza się ku temu okazja.

Szczególne moje zdziwienie wywołał lepiężnik biały, Petasites albus.

Jeżeli weźmiesz do ręki, Przyjacielu, jakieś opracowanie na temat flory polskich Karkonoszy, przeczytasz zapewne, że lepiężnik jest tu rośliną bardzo pospolitą. Tymczasem od wielu lat już nie widuję go po polskiej stronie gór. Jakież było moje zdziwienie, kiedy schodziłem z gór w kierunku Špindlerova Mlýna i zobaczyłem, że tu, w czeskich Karkonoszach rośnie on dosłownie wszędzie w dużej ilości. Różnica między północną a południową stroną gór jest tak uderzająca pod względem występujących tu i tam roślin, że aż zastanawiająca.

Tymczasem lepiężnik, znany w Czechach jako devětsil bílý – to roślina cenna, wykazująca łagodne działanie przeciwbólowe. W dawnych czasach nawet jako jeden z nielicznych ówcześnie dostępnych środków potrafiła przynieść pewną ulgę chorym na dżumę.

Inną rośliną, o którą podobno powinienem się aż potykać po polskiej stronie gór, a której ni widu, ni słychu – jest pierwiosnek wyniosły Primula elatior. Mapa rozmieszczenia roślin naczyniowych w Polsce z roku 2001 zakropkowała całe południe Polski udokumentowanymi stanowiskami tej chronionej rośliny, ale zdaje się, że po dwudziestu latach sporo się w tym zakresie zmieniło. Na gorsze.

Tymczasem w Špindlerově Mlýně pierwiosnka wyniosłego napotkać można nawet przy szosie z Vrchlabí.

A oto kolejna roślina, której próżno szukać po polskiej stronie, choć również powinna być często spotykana:

Śledziennicę skrętolistną Chrysosplenium alternifolium spotkać można po czeskiej stronie gór niemal wszędzie. Wszelkie źródła twierdzą, że Polska nie ma się czego wstydzić pod tym względem, ale… od dawna nie widuję jej u nas.

Gatunkiem na szczęście i po polskiej stronie gór bardzo częstym jest za to zawilec gajowy Anemone nemorosa.

Oczywiście, jeśli chodzi o powyższe utyskiwania, zawsze moje oczy to tylko moje oczy, więc być może te rośliny istotnie można spotkać i w polskich Sudetach, a ja ich po prostu nie zauważyłem. Jednak chodząc po górach i rozglądając się za tym, co w lesie rośnie, w Czechach napotkałem je natychmiast, w przeciwieństwie do Polski. Nie twierdzę więc kategorycznie, że ich już w Polsce nie ma – twierdzę tylko, że chyba już nie są aż tak pospolite, jak kiedyś.

Nie pierwszy to zresztą raz, gdy spotykam się z radykalnymi różnicami między obiema stronami tych samych przecież gór.

Odwiedzający czeskie Sudety często napotkają stare, omszałe, betonowe budowle, nikomu dziś niepotrzebne i w spokoju rozpadające się w lasach i na stokach gór. Przypominają one o burzliwej historii tych ziem.

Są to tak zwane „řopíki” – czyli niewielkie bunkry, budowane w latach 30-tych ubiegłego wieku pod nadzorem ŘOP – Ředitelství obranných prací (Dyrekcji Robót Obronnych), które były elementem rozległej sieci fortyfikacji granicznych. Miała ona chronić kraj w niestabilnych czasach międzywojnia przed agresją państw ościennych.

Nie będę tu opisywał tych dziejów, w końcu nie jest to strona o najbardziej grząskiej z nauk, czyli historii – a każdy, kto ma ochotę, może sobie w innych miejscach poczytać o tym, jak kosztowne obwarowania okazały się bezużyteczne na skutek tego, że wielcy przywódcy mocarstw europejskich zwykli są cierpieć na syndrom sztokholmski wobec krwawych dyktatorów.

Czy jednak na pewno bunkry okazały się bezużyteczne? Dziś budowle te, powoli zasypywane liśćmi, zarosłe mszakami stają się często ostoją nietoperzy, ptaków i rozmaitych bezkręgowców. Przyroda umie wykorzystywać odpadki ludzkiej historii z zadziwiającą rozumnością, przy której wstydem powinna napawać nas, ludzi bezrozumność naszych wojen i kompletnie nikomu niepotrzebnego szamba, zwanego polityką.

Z lasu bezszelestnie, bez najmniejszego nawet dźwięku wysunęły się dwie łanie. Jak to jest, że świat Przyrody jest światem tak cichym, a ludzki pełen jest hałasu i to nie tylko tego dźwiękowego, ale też hałasu stresu, wydarzeń, informacji?

Może zacznijmy od tego, że to nie do końca tak jest. Przyroda przecież też potrafi być bardzo głośna, a ludzie też często pragną ciszy.

Różnica znów polega właśnie na rozumności. W Przyrodzie zarówno hałas jak i całkowita cisza są używane, gdy są potrzebne. Łanie czuły w Bojarze wilka – dlatego na wszelki wypadek przeszły obok nas, nie czyniąc najmniejszego szmeru.

Tymczasem ludzie zupełnie nie używają rozumu, gdy chodzi o dźwięki, jak i o ciszę. Ludzkie samce uwielbiają się przekrzykiwać, prześcigać w tym, o ile głośniejszy pierd będzie miał silnik ich motocykla – mimo, że nie ma to żadnego znaczenia ani dla pozyskania środków do życia, ani zdobycia partnerki do rozrodu. Gdy są zmęczeni hałasem, biegną do kościelnej mistyki i poszukują „duchowości” – wpędzając się tylko w kolejną kakofonię, tym razem teologicznego bełkotu i bezpardonowych wojen religijnych.

My tymczasem dochodzimy do szczególnego miejsca.

Karkonosze składają się z wielu masywów, grzbietów i ciągów wzniesień. Dwa jednak są najwyższe: Śląski Grzbiet, przez który przebiega granica czesko-polska, oraz Czeski Grzbiet, składający się tak naprawdę z dwóch, biegnących równolegle do Śląskiego Grzbietu, a pośrodku oddzielonych przerwą, przez którą w dalszą drogę wypływają z gór wody rzeki Łaby.

Pomiędzy Śląskim a Czeskim Grzbietem płyną dwa największe potoki, zlewające się ze sobą pośrodku w tej właśnie przerwie: Łaba „główna” płynie od zachodu, a Biała Łaba – od wschodu.

Tu właśnie, u zbiegu dolin dwóch potoków, między grzbietami najwyższych czeskich gór łączą się one w miejscu zwanym Sedmidolí.

Warto wspomnieć, że sprawa tego, iż to zachodni potok uważamy za Łabę, a wschodni za jej dopływ Białą Łabę, jest dość niedawnym, umownym ustaleniem geograficznym. W tradycji bowiem mieszkających w Karkonoszach ludzi Łaba ma siedem źródeł, z których siedem potoków (dwa największe wspomniane wyżej oraz pięć mniejszych) z siedmiu dolin (stąd nazwa Sedmidolí) łączy się tutaj w jedną, prawdziwą, świętą rzekę Łabę.

My udamy się wzdłuż potoku płynącego z zachodu.

Zadziwiające jest to, że Łaba ledwie siedem kilometrów od źródła opuszcza  swoją dolinę jako wielki, rwący i napełniający las potężnym szumem potok. Jest to jednak zasługa tego, że po drodze wpada do niej wiele mniejszych potoków, strumieni i strumyczków, zlewających się po stromych, górskich zboczach, tworząc tutaj prawdziwą dolinę wodospadów.

Kraina czeska była, podobnie jak Śląsk zamieszkana w ciągu dziejów przez wiele ludów, jednak wszyscy – przygodni czy zostający tu na dłużej mieszkańcy ulegali urokowi tutejszego piękna. W szczęśliwych czasach, zanim nastała w Europie era dwóch najobrzydliwszych i najokropniejszych religii świata, czyli chrześcijaństwa i islamu, ludzie czcili – bezpośrednio, lub pod postacią mniej lub bardziej symbolicznych bóstw – samą Przyrodę. W tej czci szczególne miejsce znalazło się dla Łaby, jednej z największych europejskich rzek, która właśnie tutaj bierze swój początek.

Niegdyś to ta właśnie rzeka postawiła granicę okrucieństwu rzymskiego imperium, którego przetrwalnikiem i dzielnym kontynuatorem jest instytucja katolickiego kościoła.

Zaiste więc, zasługuje ta rzeka, by nazwać ją świętą, a dziś, po wielu wiekach, gdy Europa wciąż niepewnie i w bólach budzi się ze snu religijnych przesądów, może piękno tego kraju nauczyć nas na powrót oddawać cześć temu, co na cześć rzeczywiście zasługuje, czyli Przyrodzie: prawom fizyki, chemii i biologii. Prawom jedynego prawdziwego życia, poza którym żadnego innego nie ma, a które teraz, Przyjacielu, porusza twoje piersi w oddechu, przetacza krew w twoich tętnicach i depolaryzuje błony komórkowe Twoich neuronów, pozwalając ci myśleć, czuć, przeżywać.

Dochodzimy do miejsca, gdzie dno doliny Łaby zalega podłużny, wysoki wał o stromych skłonach. To morena czołowa dawnego lodowca górskiego. W czasie ostatniego zlodowacenia śniegi w górach nie topniały latem, z roku na rok nawarstwiając się każdej zimy nowym śniegiem, aż przygnieciony ciężarem wyższych warstw sprasowany śnieg zmieniał się w lód. Pod wpływem ciśnienia topił się on w kontakcie ze skałami, to znów – gdy latem ciężaru ubywało, a ciśnienie zmniejszało się – zamarzał, powoli rozsadzając skały podłoża. Nowy śnieg wędrował z roku na rok coraz głębiej, a stary powoli przesuwał się w dół zboczy górskich żłobiąc je i zabierając ze sobą oderwane od gór skały. Jeśli klimat sprawiał, że czoło lodowca przez dłuższy czas stało w miejscu, bo topniało w tym samym tempie, co napływał z góry nowy lód – z nanoszonych kamieni usypywał się powoli taki właśnie wał, zwany w geologii moreną czołową.

Gdy ustąpiła ostatnia epoka lodowcowa morena czołowa, tarasując dno doliny niczym zapora utworzyła wielkie jezioro, które było tutaj jeszcze 6000 lat temu. Później jednak coraz bujniejsza roślinność zarastała je, drzewa zasypywały igłami, liśćmi, nasionami i gałęziami, potoki z gór nanosiły piasek, kamienie i jeszcze więcej materii organicznej – aż wreszcie jezioro całkowicie zarosło i dziś pozostała po nim jedynie płaska, zabagniona przestrzeń zajmująca dno doliny.

Wiemy to z odwiertów, które wykazały, że pod naszymi stopami leży tutaj 5 metrów torfu. Torf powstaje, gdy miejsce jeziora zajmie bagno – a z tempa jego odkładania obliczyć możemy, ile lat minęło od tego czasu.

Łaba rozlewa się tutaj szeroko, pozwalając choć trochę wyobrazić sobie, jak mogła wyglądać dolina w czasach tuż po zlodowaceniu.

Podmokłe dno doliny zajmują torfowiska, bagna i młaki, dając schronienie tym roślinom, które pożądają dużej wilgoci, a także płazom i bezkręgowcom. Miejscami krajobraz do złudzenia przypomina pejzaże syberyjskiej lub kanadyjskiej tajgi.

Ktoś, być może któryś z pracowników Krkonošskeho narodního parku, zainspirowany tajemniczym pięknem tego miejsca wyrzeźbił w resztce pnia złamanego przez wichurę drzewa podobiznę sowy.

Dolina Łaby, w przeciwieństwie do Doliny Białej Łaby, nie została wyrzeźbiona przez rzekę, tylko przez lodowiec. To sprawia, że ma ona w przekroju kształt litery „U” – posiada strome, skaliste zbocza i szerokie, płaskie dno. Doliny, które powstały wskutek erozji rzecznej mają zwykle kształt litery „V” – a więc nachylone zbocza i wąskie dno. Można powiedzieć, że dolina polodowcowa, taka jak dolina Łaby, jest odwróceniem porządku, do którego zwykle przyzwyczaja nas Przyroda: podczas gdy zwykle najpierw jest rzeka, a potem dolina – tutaj było na odwrót. Wpierw lodowiec wykonał pracę wydrążenia doliny między górami, a dopiero po jego ustąpieniu popłynęła nią rzeka.

Mijamy Dvorský potok, doprowadzający do Łaby wody z jednego z jej siedmiu źródeł. Źródło to znajduje się dużo wyżej, pod  szczytem Wysokiego Szyszaka, czwartej co do wysokości góry Karkonoszy, po czesku zwanej Vysoké kolo.

Jeśli obrócimy się za siebie, zobaczymy stąd w oddali wylot doliny Białej Łaby i ostrogę Kozí hrběty, wschodniej części Czeskiego Grzbietu Karkonoszy.

Zbliżamy się do miejsca, gdzie porośnięte lasem zbocza doliny ustępują wyniosłym skałom, piargom i stromiznom, po których często w zimie schodzą lawiny. To Labský důl – Łabski Kocioł.

Zanim jednak tam dojdziemy, napotkamy tak zwany Malý Labský vodopád, Mały Wodospad Łaby, nazwany tak w odróżnieniu do Wodospadu Łaby, który znajduje się dużo dalej, na samym końcu Łabskiego Kotła, a który już kiedyś odwiedziliśmy w opisywanych tutaj wyprawach (patrz: Kraina zatrzymanego czasu. Wyprawa do źródeł Łaby).

Mały Wodospad Łaby ma wysokość zaledwie pięciu metrów, ale za to płynie nim cała moc wód wielkiej, górskiej rzeki, wzmocniona jeszcze topniejącymi na górskich zboczach śniegami.

Ze ścieżki, biegnącej wzdłuż potoku można tutaj zejść, aby z niewielkiego cypelka ujrzeć wodospad od dołu. Gdy tak uczyniłem, poczułem, że od wodospadu uderza we mnie potężny podmuch, niosący ze sobą wodną mgłę. To była dla mnie niesamowita chwila, bo oto odczułem na sobie potężny oddech świętej rzeki Łaby.

I teraz powiedz mi, Przyjacielu, mi stojącemu twarzą w twarz z majestatem potęgi Przyrody: dlaczego niby miałbym, jak wciąż próbują mi rozkazywać ludzie, klękać przed impotentem, chrześcijańskim bogiem, skoro widzę tutaj prawdziwą rzeczywistość, która mnie przerasta, potęgę istniejącą niezależnie od mojego umysłu? Oto wielkość Przyrody, majestat przed którym nie wstyd klęknąć, bo rzeczywiście istnieje i rzeczywiście jest potężny, w przeciwieństwie do chrześcijańskiego boga, który jest marionetką, bez ograniczeń wykorzystywaną przez oligarchów w sutannach do kontrolowania ogłupionych owieczek i ściągania z nich danin.

Jeżeli odpowiesz mi na to, że przecież Przyroda nie jest potężniejsza od człowieka, bo mógłby człowiek na przykład przegrodzić tutaj dolinę zaporą i ujarzmić tę wodę – to bardzo się pomylisz. Przyroda ma czas, poczeka aż umrą ci, którzy wznoszą zapory, poczeka, aż skończą się pieniądze na ich konserwację, a wtedy zawsze prędzej czy później taka zapora pęknie i pozostaną z niej ruiny, jawnie szydzące z ludzkiej arogancji.

Tymczasem na przykład ksiądz Marcial Maciel Degollado mógł spokojnie przez całe swoje długie życie gwałcić dzieci, nastolatków, płodzić dzieci z kobietami, które uwodził i oszukiwał – a wszystko to powołując się na Jezusa Chrystusa, podobno „prawdziwego boga”, który przez 60 lat nie znalazł czasu, żeby w jakikolwiek sposób przeciwko temu zaprotestować. Logika nakazuje uznać, że są tylko trzy możliwości: albo tenże bóg Jezus nie istnieje, albo nic nie może zrobić, więc jest impotentem i nie ma sensu go czcić – albo mu się taka „działalność” księdza Marciala podobała, więc jest potworem i tym bardziej nie warto się do niego modlić.

Wierzący często odpowiadają z oburzeniem, że ja, tak zachwycony Przyrodą mam wręcz psi obowiązek wierzyć i jęczeć na kolanach przez Jezusem, bo, jak twierdzą, to właśnie Przyroda świadczy o jego rzekomej potędze i dobroci.

Tymczasem chwałę chrześcijańskiego, islamskiego czy jakiegokolwiek innego boga usłyszeć można w huku wodospadu tylko wtedy, gdy ma się tak naprawdę gdzieś ten wodospad, ma się gdzieś jego piękno, a idzie się w góry z oczami zasłoniętymi przez klapy religijnego obłąkania.

Przyroda świadczy tylko i wyłącznie o swojej własnej chwale, piękno wodospadu jest pięknem tylko i wyłącznie tego wodospadu, tej rzeki, tej wody – i temu pięknu głęboko ubliża odnoszenie go do tak marnych postaci, jak Jezus, Mahomet czy Zeus.

Ileż to razy, co już naprawdę jest nudne, słyszałem jęki, jakobym to był idiotą, który „obraził” się na „pana boga” i dlatego „utracił” wiarę, a teraz „żeby to sobie zastąpić” uważam Przyrodę za godną mojego podziwu.

Ale w moim życiu było dokładnie na odwrót. Zachwyciła mnie i olśniła potęga Przyrody, gdy jeszcze wierzyłem w Jezusa i nie miałem co do tej wiary najmniejszych wątpliwości. I zobaczyłem, że nie mogę naraz kochać rzeczy tak bardzo sobie przeciwnych, gdzie po jednej stronie miałem realną, olśniewającą potęgę, tak wielką, że stojącą ponad dobrem i ponad złem, potęgę, której równorzędnymi elementami jest słodki zapach kwiatów i unurzany we krwi pysk wilka – a po drugiej kogoś, kogo nikt nigdy nie widział, a o jego woli można się dowiedzieć jedynie za pośrednictwem hierarchii kościelnej i bezdennie nudnych wywodów teologicznych lub nie mniej bezdennie nudnej księgi, która na co drugiej stronie przeczy sama sobie i opowiada zupełnie nieprawdopodobne historie.

Miałem do wyboru: po jednej stronie widzialną, dostępną badaniu przez eksperyment i obserwację potęgę Wszechświata, który mimo tego badania nic nie traci ze swojej potęgi i tajemnicy – a po drugiej kogoś, kto zapewne straszliwie się boi, żeby go nikt nie badał, bo ukazuje się – podobno – tylko nieuczonym „prostaczkom”.

Nauka i religia są ze sobą zgodne tylko w oczach ludzi, którzy nigdy nie zajęli się na poważnie nauką albo religią.

Ja poznałem na poważnie zarówno jedno, jak i drugie i z całkowitą pewnością mogę powiedzieć, że jedno jest biegunowo odległe od drugiego, do głębi sprzeczne i niemożliwe do pogodzenia bez zgwałcenia którejś ze stron.

Dokonałem wyboru. I ku ubolewaniu religiantów, nie zamierzam z tego powodu odczuwać najmniejszego żalu.

Mijamy Pudlavský vodopád, toczący ku Łabie wody kolejnego jej dopływu.

Przebyliśmy już ponad dwie trzecie długości Doliny Łaby, ale ona zdaje się być równie potężną rzeką, jaką była u początku naszej drogi.

To tutaj, ze zbocza gór naprzeciwko miejsca, gdzie teraz stoimy, w roku 1956 zeszła jedna z największych lawin w historii Czech, której długość sięgnęła blisko półtora kilometra i zmiotła dziewięć hektarów lasu.

Tym jest właśnie Przyroda, zabija bez litości, a w zamian daje życie innym, w tym wypadku drobnym, zielnym roślinom, które nie mogłyby rosnąć w ciemnym lesie, ale dzięki lawinom zyskują miejsce do życia.

Przyroda nie patrzy na żadne kryteria dobra ani zła, czyni i jedno i drugie z identyczną hojnością. Ludzcy bogowie, którzy są według ludzi doskonałym dobrem i nie mogą czynić żadnego zła, nie mogą zatem czynić co najmniej połowy tego, co uczynić w ogóle można. Dlaczego więc zwać ich wszechmogącymi?

Przyrody nie krępują żadne przykazania, żadne żałosne dekalogi. Nawet prawa fizyki dają się na tysiące sposobów modyfikować, a w przypadku wielu tak zwanych stałych fizycznych udowodniono, że wcale stałe nie są, lecz zmieniają się na tyle powoli, że dały nam takie złudzenie.

Po skalistym zboczu polodowcowego kotła spływa wiele wodospadów – niektóre płyną tu stale, inne tylko w czasie deszczu lub roztopów. Ale wszystkie napełniają ten ogromny skalny amfiteatr śpiewem stokroć piękniejszym od zawodzeń chorału gregoriańskiego.

Co ciekawe, miejsce to dzięki jednemu szczegółowi daje nam okazję do zastanowienia się nad… nowoczesną architekturą. W pewnym momencie, gdy odpowiednio zagłębimy się w Łabski Kocioł, zobaczyć możemy schronisko Labská bouda.

Uznany w Polsce za nieomylny autorytet w kwestii geografii, historii i kultury Karkonoszy Marek Staffa w swojej książce „Karkonosze” wydanej jako część serii „A to Polska właśnie”, rozpływa się nad „pięknem” polskiego budynku obserwatorium meteorologicznego na Śnieżce, słynnymi „talerzami”. Pisze, że jest to „najbardziej interesująca, oryginalna budowla w polskich górach”, że słusznie „urasta do rangi symbolu Karkonoszy”. Jednocześnie wybudowane w podobnym czasie schronisko Labská bouda nazywa „koszmarnym”, a przy tym kąśliwie sugeruje, że zgłaszane przez czeską stronę zastrzeżenia do „talerzy” na Śnieżce wynikają z… zazdrości.

Tymczasem jeśli ktoś nieprzygotowany znajdzie się tu, w dolinie Łaby, może tego całkiem dużego schroniska w ogóle nie zauważyć. Projektant postarał się bowiem, żeby bryłę schroniska maksymalnie upodobnić, tak kształtem, jak fakturą i barwą do skalnych wieżyc, wystających z górskich zboczy.

I choć nie cierpię nowoczesnej architektury, podczas tej wędrówki musiałem przyznać, że architekt zrobił, co mógł, żeby ludzką budowlą jak najmniej oszpecić naturalny krajobraz. Czego zupełnie nie można powiedzieć o „dziele” polskich architektów na Śnieżce.

Naprawdę, widząc to blaszano – betonowe coś na Śnieżce nie rozumiem, czego Czesi mieliby w tym momencie „zazdrościć”.

Dochodzimy wreszcie do celu naszej dzisiejszej wędrówki – do najwyższego wodospadu Czech i całych Sudetów, do Pančavského vodopádu.

Podczas, gdy po śląskiej stronie gór znaleźć możemy wodospady o maksymalnej wysokości 27 metrów, Pančavský vodopád liczy sobie aż 148 metrów.

Podobno słynny genetyk amerykański, Francis Collins, podczas górskiej wędrówki „nawrócił się” na widok potrójnego wodospadu, który uznał za… dowód istnienia trójcy świętej. I padł na kolana przed Jezusem i odtąd dawny kierownik projektu poznania ludzkiego genomu z niestrudzonym fanatyzmem zaczął głosić „całkowitą zgodność” nauki z wiarą.

Na nieszczęście wierzących wiem, jak w jego czasach wyglądało poznawanie ludzkiego genomu. Ze względu na bardzo czasochłonną metodę, którą wtedy operowano, musiało być to potwornie nużące zajęcie. Dość powiedzieć, że zastępom naukowców z wielu krajów blisko trzydzieści lat zajęło pełne poznanie sekwencji ludzkich genów, przy czym dokończono je tylko dzięki wynalezieniu o wiele wydajniejszych metod po drodze. Kod genetyczny człowieka składa się z ponad trzech miliardów „literek”, odpowiadających sekwencji zasad azotowych w cząsteczce DNA, których jest ni mniej, ni więcej, tylko cztery: adenina, guanina, cytozyna i tymina. Teraz wyobraź sobie, Przyjacielu, że ślęczysz przez osiem godzin dziennie nad ciągiem literek: AAACGTTAGGGCCAATTTGTACCTAG… i tak dalej, i tak dalej, całe setki, tysiące, miliony tych samych liter. Idziesz potem w ramach odprężenia na górską wycieczkę.

No cóż, po czymś takim nic dziwnego, że pan Collins ujrzał w wodospadzie trójcę świętą.

Pančavský vodopád nie potrzebuje żadnej trójcy świętej do tego, żeby olśniewać, i jeśli jest sens padać na kolana, to tylko i wyłącznie przed samą w sobie wodą, samym w sobie majestatem skał i samym w sobie pięknem Przyrody.

Obok najwyższego wodospadu Sudetów ujrzeć możemy wiele innych, opadających na dno kotła wód. Jeden z nich otrzymał nazwę Hančův vodopád dla upamiętnienia czeskiego narciarza Bohumila Hanča, którego w czasie odbywających się w marcu 1913 roku zawodów narciarskich zaskoczyła nagła zmiana pogody. Zgubił się w potężnej, niespodziewanej śnieżycy, a gdy go odnaleziono, był tak wyziębiony, że zmarł niedługo po tym, jak przyniesiono go do Labské boudy.

Tak, Przyroda bywa okrutna, ale w swoim okrucieństwie zawsze jest beznamiętna, uderza nie w akcie kary za coś, ale w geście czystego przypadku. I w tym geście tworzy zarówno rzeczy przerażające, jak zaskakująca samotnego narciarza śnieżyca, jak i piękne, jak tak zwane krkonošské zahrádky, „ogródki” karkonoskie.

Wiatry wiejące z północy niosą ze sobą pył i nasiona wielu roślin. Specyficzne ukształtowanie powierzchni Karkonoszy, gdzie w wielu miejscach naprzeciw północnego, łagodniejszego stoku następują po drugiej stronie gór przepaści polodowcowych dolin, takich jak Obří důl pod Śnieżką czy właśnie Labský důl – sprawia, że naniesione tu z północy nasiona opadają u stóp skalnych ścian. Regularnie schodzące lawiny uniemożliwiają rozwój jakimkolwiek drzewom czy większości krzewów, przez co z naniesionych przez wiatr roślin może się tu swobodnie rozrastać ogromne bogactwo nieraz bardzo rzadkich ziół, których doliczono się łącznie 250 gatunków.

Można od tego miejsca iść dalej, aż do schroniska Labská bouda, jednak my się tu zatrzymamy. Jeśli jesteś ciekaw, Przyjacielu, Łabskiego Wodospadu, schroniska i źródeł Łaby, jeszcze raz zapraszam Cię do opisu innej wyprawy, gdzie dotarliśmy tam z Bojarem od śląskiej strony gór, a do którego link wstawiłem już nieco wyżej.

Tym razem wolałem tu pozostać. Podróż na czeską stronę Karkonoszy sprawił, że poczułem się, jakbym zawitał do zupełnie innego świata, choć pozostałem przecież wciąż w tych samych, tak dobrze sobie znanych górach. Nie chciałem sobie psuć tego wrażenia oglądaniem dobrze znanych miejsc. Także Bojar nie jest już tak młody, jak kiedyś, a droga po wciąż głębokim śniegu była dla niego męcząca.

U stóp wodospadu Pančavy odpoczęliśmy przed powrotną drogą, jeszcze raz przemyśliwując nad tym wszystkim, czego nauczyła nas dzisiaj Przyroda.

Siedzieliśmy długo w królestwie dzikich ziół, lawin, wysokich wodospadów i wyniosłych skał, z dala od katolickiego, polskiego grajdołka, w którym dla przykładu pewien znajomy reklamuje mi się swoimi zdjęciami z księżmi i pielgrzymkami do Częstochowy, z niewiadomego dla mnie powodu sądząc, że mnie w ten sposób „nawróci”.

Nie raz to mówiłem i znów to powtórzę, że gdyby wiara chrześcijańska miała rację, a ateiści się mylili, to stokroć większy sens byłby w czczeniu Szatana, niż ich żałosnego boga.

Zakochany jestem w tych wodospadach, w Bojarze, w śnieżycach i lawinach, w roślinach zielnych porastających karkonoskie łąki i lasy, zakochany w eksperymencie i obserwacji, w wiedzy i prawdzie, do której dochodzi się tylko poprzez materialną rzeczywistość skał, związków chemicznych, zjawisk fizjologicznych w tkankach roślin i przez często żmudną drogę wśród głębokich zasp.

Jeśli kiedyś odwiedzisz, Przyjacielu ten zakątek świata, podziwiaj go, podziwiaj całym sobą tak w jego całości, jak i w szczegółach. A poznasz, że żaden człowiek, żadna religia, filozofia ani żaden ludzki bóg nie da ci tego, co chwila przyglądania się i wsłuchiwania w szum opadającej po skalnych ścianach wody.

I tak mógłbym zakończyć opowieść o tej wędrówce, ale… czegoś tutaj brakuje. Czego? Ach, pewnego drobnego epilogu.

Epilog ten zawsze jest podobny, po każdej górskiej wędrówce. Kiedy powróciliśmy, czując w nogach przebyte kilometry, a w głowach kłębowisko wrażeń, kiedy z tą wyuzdaną, bezwstydną świadomością, że nie obchodzi mnie, co będzie jutro, bo nic ważnego nie mam i nie zamierzam mieć do zrobienia, żadnego świata do zbawiania ani ludzkości do nawracania, żadnych modłów do odmówienia, mszy do zaliczenia ani biznesów do uskutecznienia – gdy więc z tą świadomością rozsiadłem się przed oknem, przez które dochodził do mnie szum Łaby, zapach lasu i przez który widziałem pogrążający się w półmroku wieczoru Biały Most – poczułem przyjemność. Czyli to, czego odczuwania zabraniają kaznodzieje nawołujący do pokutowania za grzechy.

Pełnych tej właśnie przyjemności wieczorów po długich, górskich wędrówkach Tobie życzymy Przyjacielu, Bojar i ja.

Social Share Buttons and Icons powered by Ultimatelysocial